VOLUME 66 : 2018

Type 2 diabetes mellitus (T2DM) is a chronic disease that is increasing at an alarming rate in Asian countries including the Philippines. The aim of this study is to optimize PCR conditions to detect SNPs within the susceptibility genes KCNQ1, TCF7L2, and DPP4 and to verify if mutations within these genes are targeted. PCR conditions were optimized for each of the genes using gene specific primers. These conditions were then used to detect single nucleotide polymorphisms (SNPs) in each of the susceptibility genes of the selected samples. Gene specific primers were designed based on the translated regions of the target genes. For TCF7L2, F/R (GGCTTTCTCTGCCTCAAAACC/ACTAAGGGTGCCTCATACGG); for DPP4 – F/R (CCCAGGTTCGCTGACAAATC/TCATTCCACGGTTGCAGGTG) and for KCNQ1- F/R (GTAAGCAGATGACAGGGCAGT /TAAAGGTCCT GACCCCCACC). Template DNA was obtained from patients of the University of Santo Tomas Hospital (USTH). The final concentration of the PCR components are: 1X 2X Taq Master Mix, 10 M forward and reverse primers, and 2ng DNA template. For the PCR conditions: initial denaturation, 3 min; 35 cycle of denaturation, 1 min, annealing, 1 min, elongation, 1 min and; final elongation of 5 min. The annealing temperatures were optimized at 58.3°C for KCNQ1 and 54.5°C for TCF7L2. The genes were successfully amplified giving the correct fragment lengths. The designed primers and PCR conditions for KCNQ1 and TCF7L2 were effectively used to verify the SNPs within the susceptibility genes.